Download and Installation

KnotSeeker has been implemented in Python. If you don't have Python on your local machine, you can download it for your platform from http://www.python.org. Please ensure that Python 2.5 or later is installed, otherwise KnotSeeker will not be able to run.

As the next step, download KnotSeeker.py and place it in your working directory. Alternatively, you can download KnotSeeker with several test sequences from our paper bundled in a zip file.

It is important to note that KnotSeeker makes use of the freely available tools pknotsRG (Version 1.3), GUUGle, and RNAeval (Vienna RNA package 1.7). Therefore, it is essential to compile and install these three tools from source on your own machine (Unix, Mac, or Cygwin for Windows) for running KnotSeeker. After downloading, usually you'll just have to unpack, configure and make. Please make sure that you install all three of them in your KnotSeeker working directory.

INSTRUCTIONS FOR INSTALLING PKNOTSRG

gzip -cd pknotsRG-1.3.tar.gz | tar xvf -
cd pknotsRG-1.3
./configure
make
and (as root)
make install

If problems occur, see here.

INSTRUCTIONS FOR INSTALLING GUUGLE

gzip -cd guugle-1.1.src.tar.gz | tar xvf -
cd guugle
make

If problems occur, see here.

INSTRUCTIONS FOR INSTALLING RNAEVAL

tar -zxvf ViennaRNA-1.7.tar.gz
cd ViennaRNA-1.7
./configure
make
and (as root)
make install

If problems occur, see here.

The following paths to pknotsRG, GUUGle, and RNAeval should now exist in your working directory (all executable files):

working directory/ViennaRNA-1.7/Progs/RNAeval
working directory/guugle/guugle
working directory/pknotsRG-1.3/src/pknotsRG

Please note: if the paths have different names or do not exist, KnotSeeker will not be able to run properly!

Running KnotSeeker

KnotSeeker takes a sequence file in FASTA format as an input. Simply change to your working directory and type in the sequence file name as an argument, e.g. TMVup.fasta.

python KnotSeeker.py TMVup.fasta

Pseudoknot detection starts...
Detected pseudoknots for TMVup

Position: 11 ... 31
ACGGAUUGUGUCCGUAAUCAC
((((((.[[))))))....]]
Energy calculated by pknotsRG: -6.9 kcal/mol

Position: 33 ... 53
CGUGGUGCGUACGAUAACGCA
((((.[[[[))))....]]]]
Energy calculated by pknotsRG: -8.2 kcal/mol

Position: 55 ... 84
AGUGUUUUUCCCUCCACUUAAAUCGAAGGG
((((.....[[[[.))))........]]]]
Energy calculated by pknotsRG: -5.4 kcal/mol

There are three detected pseudoknots for sequence TMVup. We give the start and end positions of each pseudoknot with respect to the input sequence.

Return to the KnotSeeker start page for submitting a sequence