Links

• pknotsRG Practical RNA folding including simple recursive pseudoknots
• GUUGle Exact matching under RNA base pairing rules
• Vienna RNA Package Toolbox for prediction and comparison of RNA secondary structures

Reference

• Jana Sperschneider and Amitava Datta. KnotSeeker: Heuristic pseudoknot detection in long RNA sequences. RNA. 2008; 14(4): 630-40.
  Abstract

Contact

• For comments and suggestions contact janaspe(at)csse.uwa.edu.au

Manual

We set the maximum sequence length limit to 1000 bases for online submission. If you want to run KnotSeeker on longer sequences, please install it on your local machine. The Python code and instructions can be found here.

Input Format

Please provide a sequence ID for future reference. Paste your sequence in plain format into the appropriate field. Please ensure that only bases A,C,G,U are used. If you would like to be notified when your computation is done, also give your email address (optional).

Example

Sequence ID:

RNA Sequence (plain format): UCAAGUAUUCCGAAGCUCAACGGGAAAAUGAGCUA

Output Format

Approximate running times for KnotSeeker are in the order of seconds. KnotSeeker will return the detected pseudoknots (if any) in the following format. Each pseudoknot is displayed in Dot-Bracket notation. Unpaired bases are indicated by dots. Base pairs are written as bracket pairs. The first stem of a pseudoknot is indicated by round brackets , i.e '(' and ')'. The second stem of a pseudoknot is indicated by square brackets, i.e. '[' and ']'. We also give the start and end positions of the pseudoknot with respect to the input sequence.

Example

Visualization

For visualization of RNA secondary structures with pseudoknots, we recommend using PseudoViewer. PseudoViewer supports the Dot-Bracket notation as input format. For our example, the 2d-drawing looks like this:

Return to the KnotSeeker start page for submitting a sequence